Helen Frankenthaler Foundation

Scar reduction peptide

A short peptide potentially promotes the healing of skin wound

Abstract

Skin wound, a common form of skin damage in daily life, remains a serious challenge in clinical treatment. Bioactive peptides with high efficiency have been considered as potential therapeutic candidates for wound healing. In this report, a novel short linear peptide, with mature peptide sequence of ‘GLLSGINAEWPC’ and no obvious similarity with other known bioactive peptides, was identified by genomic method from the skin of odorous frog, Odorrana andersonii. Our results suggested that OA-GL12 (OA: abbreviation of species (O. andersonii), GL: two initial amino acids, 12: peptide length) obviously accelerated the scratch-healing of keratinocytes and human fibroblasts in a time- and concentration-dependent manner. Meanwhile, OA-GL12 showed significant effect in promoting the wound healing on the full-thickness skin wound model. Inflammatory assay results demonstrated that OA-GL12 induced the secretion of tumor necrosis factor (TNF) and transforming growth factor β1 (TGF-β1) on murine macrophage cell line (RAW264.7), which might explain the powerful accelerating capacity of wound healing. Moreover, results also indicated that epidermal growth factor receptor (EGFR) was involved in the mechanisms underlying the scratch-healing promoting activity of OA-GL12. In addition, OA-GL12 showed obvious free radical scavenging activity. Results supported that OA-GL12 did not exert risk in acute toxicity, hemolytic activity, and direct antibacterial activity. The remarkable effect of OA-GL12 on promoting wound healing verified in this research made it potential to be a novel template for the development of wound healing-promoting agents.

Introduction

Human skin wounds remain a major and snowballing threat to public health and the economy [1]. Skin is the largest tissue organ covering the human body and the physical barrier between the inner and outer environment. Inevitably, skin wound is often achieved in adverse accidents. Once damaged, the loss of the skin defense against harmful stimulus will contribute to side effects, such as infection, shock, and even death [2–4]. Especially under some conditions (diabetes, infection, et al.), the process of wound healing will be delayed and mostly inflicted chronic wounds [5,6]. Therefore, accelerating the wound healing is vital to the body. Traditional wound healing drugs, including growth factors, cytokines, chemical compounds derived or developed from plants, and other immunomodulatory factors, were particularly difficult to translate these therapies for chronic wound healing into the clinic [7]. Compared with those drugs with high cost, low activity, safety and delivery problems, bioactive peptides with high activity, specificity, and stability have aroused considerable interest in the related field of research [8–10].

Amphibian skins, such as from frogs and toads, are multifunctional organs acting in defense, respiration, and water–salt balance regulation. Because of exposing to sharp rocks, elevated ultraviolet (UV) radiation, and microbes, et al., amphibian skins are susceptible to damage. To defeat these factors, they have evolved a unique and effective polypeptide defense system in their skin secretion, which contains diversity of small bioactive peptides with diverse pharmacological bioactivities, including antimicrobial, antioxidant, and immunomodulatory activities [11]. Particularly, fresh frog skin secretion is efficient in shortening wound healing process in previous researches [12]. Recent studies also reported that bioactive peptides from secretions of odorous frog could promote the wound healing [13,14]. In this study, OA-GL12 (OA: abbreviation of species (Odorrana andersonii), GL: two initial amino acids, 12: peptide length), a peptide with excellent wound healing-promoting activity, identified from the skin of O. andersonii, a unique branch of odorous frog distributed in southwest China. OA-GL12 showed significant wound healing-promoting ability at actual concentrations both in vitro and in vivo. Our results suggested that OA-GL12 could be a novel template for the development of wound healing-promoting drug.

Materials and methods

Sample collection, animal care, and ethical statement

One adult O. andersonii specimens were collected from Yunnan, China. Before the performance of experiments, frog was provided with mealworms and housed in a 50 cm × 65 cm special container. Seven days were given to acclimate to the environment before the killing.

All related animals conformed to the guidelines for Animal Care and Use of Kunming Medical University. The protocols and procedures reached the permission of the Ethics Committee of Kunming Medical University (KMMU20180012).

cDNA synthesis, Illumina MiSeq sequencing, and processing of data

A frog was washed with deionized water and killed. Immediately, the skin was stripped, cut into pieces, and grinded in liquid nitrogen. Total skin RNA was extracted using RNAiso (TaKaRa, Dalian, China), and mRNAs were purified using the Absolutely mRNA Purification Kit (Stratagene, Canada) according to normative protocols, then the first and second strand cDNA were synthesized via SMART techniques according to our previous studies, with the cDNA encoding frog skin bioactive precursors here screened from the library with a specific 5′ PCR primer (5′-CCAAA(G/C)ATGTTCACC(T/A)TGAAGAAA-3′) encoding the signal peptide region and 3′ PCR primer (5′-ATTCTAGAGGCCGAGGCGGCCGACATG-3′) [15]. The PCR products were recovered through a DNA gel extraction kit and then sent for Illumina MiSeq sequencing commercially. Briefly, the 50–100 ng PCR products were amplified again with KAPA HiFi Hot Start Ready Mix for three cycles, using infusion primer F (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCT-specific 5′ PCR primer) and infusion primer R (CAAGCAGAA GACGGCATACGAGATCTCAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-specific 3′ PCR primer). Amplicons were purified with Agencourt AMPure XP beads (Beckman Coulter Diagnostics, Inc., U.S.A.) according to the manufacturer’s instructions and quantitated using a Qubit 2.0 Fluorometer (Life Invitrogen, Inc., Carlsbad, CA, U.S.A.). Purified amplicons were pooled in equimolar and paired-end sequenced (2 × 300) on an Illumina MiSeq platform according to the standard protocols at Genergy Biotechnology (Shanghai, China). The adaptor sequences were removed from raw files by using Trim Galore software. Paired-end reads were assembled by FLASH-1.2.11 software with the following criteria: the overlap was between 10 and 300 bp, and the maximum of mismatch rate was 0.1. Then a file with the style of fastq was obtained and this file was transformed to the style of fasta, from which repeating sequences were removed by the Fastx-toolkit software.

Peptide synthesis

The mature peptide of OA-GL12, ‘GLLSGINAEWPC’, was artificially synthesized and commercially provided by Wuhan Bioyeargene Biotechnology Co., Ltd. (Wuhan, China). Final purity of the synthetic peptide used for evaluating biological activities was higher than 95%.

Cellular wound healing activity assay

Cellular wound healing activity assay was performed as previous research [8]. Briefly, human keratinocytes (HaCaT) (KCB 200442YJ) and human skin fibroblasts (HSF) (KCB 200537) were provided by Conservation Genetics CAS Kunming Cell Bank of Kunming Institute of Zoology, the Chinese Academy of Sciences, and cultured in Dulbecco’s modified Eagle’s medium (DMEM, BI, Israel) with 10% FBS (BI, Israel) and penicillin (100 units/ml)–streptomycin (100 units/ml) in a humidified atmosphere of 5% CO 2 (37°C). The possible mycoplasma contamination was excluded by the EZ-PCR mycoplasma contamination detection kit (20-700-20, BI). Cell monolayer formation was formed by culturing the HaCaT and HSF (2.5 × 10 5 cells/well) cells in 24-well plates for 12–24 h with serum starvation and then made to the mechanical scratch wound by a sterile pipette tip (Axygen, U.S.A.). After washing with PBS twice to detach dead cells, cells monolayer was then cultured for next periods (from 0 to 24 h) in a serum-free basal medium (500 μl) with the continued presence of OA-GL12. The same volume of DMEM without OA-GL12 was made as vehicle. In addition, DMEM-serum free (500 µl) contained mitomycin C (MMC, 10 µg/ml, Sigma–Aldrich, St. Louis, MO, U.S.A.) were set with OA-GL12 (10 pM) or not. Images of the cellular wound healing monolayers were photographed by a Primovert microscope (Zeiss, Germany) at different intervals. Cell migration activity was expressed as the percentage of the gap relative to the full area of the scratch using ImageJ software (National Institutes of Health, Bethesda, MD, U.S.A.) to evaluate the repair rate of scarification.

Cell proliferation assays

Cells of HaCaT, HSF, human umbilical vein endothelial cells (HUVECs) (KCB 2012087YJ) and the murine macrophage cell line (RAW264.7) (KCB 200603YJ) (provided by Conservation Genetics CAS Kunming Cell Bank of Kunming Institute of Zoology, the Chinese Academy of Sciences, and the possible mycoplasma contamination was excluded by the EZ-PCR mycoplasma contamination detection kit (20-700-20, BI)) were cultured in DMEM supplemented with 10% FBS, and penicillin (100 units/ml)–streptomycin (100 units/ml) in a humidified atmosphere of 5% CO 2 (37°C). The cells (5000 HaCaT, 10000 HSF, 5000 HUVEC, and 5000 RAW264.7 cells/well, respectively) were added into 96-well plates containing basic DMEM (90 μl) (serum free) and incubated for 2–4 h to allow the cells to adhere to well walls. Afterward, OA-GL12 (10 μl) was added to each well and incubated for 24 h at various final concentrations. The same volume of DMEM (serum free) was added as vehicle and OM-LV20 (50 nM) [8] as positive control for HaCaT. After incubation, the respective proliferative effect on HaCaT, HSF, HUVEC, and RAW264.7 cells were tested using a CellTiter 96® AQueous One Solution Assay (Promega, Madison, WI, U.S.A.) according to the manufacturer’s instructions [16].

Transwell migration assay

Migration of HaCaT and HSF cells were tested using 24-well plates with Falcon cell culture inserts (8-μm pores; Corning, U.S.A.) as the previous study [17]. Briefly, cells were suspended in DMEM (serum free) to a concentration of 2 × 10 5/ml and were loaded into each upper chamber with a volume of 100 µl. Then DMEM (serum free) containing different concentration gradients of OA-GL12 (600 ml) was loaded into the lower chamber. Cells were incubated at 37°C for 24 h. The nonmigratory cells on the upper surface of chambers were removed carefully. Cells were fixed with methanol for 20 min and stained with 0.1% Crystal Violet for 20 min. Counts were obtained from in five randomly selected fields under a Primovert microscope (Zeiss, Germany).

Animal wound-healing assay

Adult male mice (22–25 g) from the same generation were purchased from Hunan SJA Laboratory Animal Co., Ltd (Certificate number 43004700043639, China). Mice were kept in individual ventilated cages (FENGSHI, China) system with laboratory animal room of Kunming Medical University. Mice were provided with essential food and water and the reverse of 12:12-h light/dark cycle. Mice were made full-thickness skin wound models after 7 days’ acclimation. Briefly, mice were anesthetized by intraperitoneal injection (i.p.) with 1% sodium pentobarbital (0.1 ml/20 g body weight). Dorsal hair were shaved by an electric clipper and sterilized with 75% alcohol. Two full-thickness skin wounds (8 × 8 mm) were surgically made on the back. After the surgery, the mice were placed in comfortable cages until they recovered from anesthesia. Nine mice were randomly divided into three groups. The right-sided wounds of the three groups were all treated with 20 µl OA-GL12. The left-sided wounds of the two groups were treated with the same volume of normal saline as vehicle, and the last group treated with 1 mg/ml KangFuXin (KFX, the ethanol extract of the American cockroach, Inner Mongolia Jingxin Pharmaceutical Co. Ltd, China, Z15020805) as positive control. Wounds were treated twice daily with samples and photographed at intervals of 2 days.

The condition of wounds was documented; then ImageJ software was used to estimate the wound areas (percentage of residual wound area to initial areas). Healing rate of wound (%) = [R (0) - R (2, 4, 6, 8, 10) ]/R (0) × 100%, where R (0) and R (2, 4, 6, 8, 10) denoted the remaining wound area at the same day of operation and postoperative days 2, 4, 6, 8, and 10, respectively. Wound-healing curves were constructed using GraphPad Prism software 7.0.

Tissue preparation and histological analysis

Nine mice were made full-thickness skin wound models and randomly divided into three groups as the animal wound-healing assay. Wounds were treated with samples twice daily as the above. Mouse skin wound tissues were isolated at days 5 and 10, and analyzed with Hematoxylin and Eosin (H&E) and light microscopy. Tissue samples were fixed in 4% paraformaldehyde for 24 h, and then dehydrated and hyalinized as previous study [14]. Thick tissue sections (5 μm) were cut, deparaffinized, rehydrated, and stained by H&E for the histological analysis. The images of the slices were recorded by a Primovert microscope (Zeiss, Germany). A semi-quantitative score system was used to evaluate epidermal regeneration and granulation [18]. Evaluation of dermal and epidermal regeneration through a three-point scale: (1, little regeneration; 2, moderate regeneration; 3, complete regeneration). To evaluate granulation tissue formation using a four-point scale: (1, thin granulation layer; 2, moderate granulation layer; 3, thick granulation layer; 4, very thick granulation layer). The situation of wound was evaluated by IPLab imaging software (BD Biosciences, Bedford, MA, U.S.A.). Neo-epithelium breadth and distances of wound site were measured, then the percentage of re-epithelialization (%) = [(distance covered by neo-epithelium)/(distance between wound site) × 100] was analyzed.

Inflammatory assay

RAW264.7 cells were cultured in DMEM (BI, Israel) supplemented with 10% (v/v) FBS Hyclone) and antibiotics (100 units/ml penicillin and 100 units/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO 2. As for the immunomodulatory activity of samples, tumor necrosis factor (TNF) and transforming growth factor β1 (TGF-β1) were tested referring to previous researches [15,19]. In short, the cells (1 × 10 5/well, respec